A STUDY OF SOCIODEMOGRAPHIC CHARACTERSTICS, ANXIETY & DEPRESSION IN WOMEN WITH POLYCYSTIC OVARIAN SYNDROME

Background: Polycystic ovarian syndrome (PCOS) is the most common and distressing disorder of reproductive age group female which include symptoms like amenorrhea, hirsutism, obesity, acne, infertility etc. Because of these distressing symptoms PCOS has been associated with significant psychiatric morbidity. Aims & objectives: 1.To study the sociodemographic characterstics of females with PCOS. 2.To find out the frequency of different symptoms in females suffering from PCOS. 3.To study the prevalence of anxiety and depression among females suffering from PCOS. Materials & methods: 30 consecutive female patients attending gynae OPD from 1/3/2022 to 1/4/2022 suffering from PCOS as per Rotterdam criteria diagnosed by a consulatant gynaecologist were taken for the study. They were thoroughly evaluated on a specially designed semistructred proforma,GHQ-12,Hamilton anxiety rating scale, Beck's depression inventory and PCOS questionnaire. Results were analysed using suitable statistics. Result and conclusion: Majority (60%) of the patients were from the age group 25-30 years. Most common symptom of PCOS in the patient was menstrual irregularity(90%) followed by obesity(80%), hirsutism(50%), acne(40%), alopecia(20%) and acanthosis nigricans(10%), 33%of the patients showed clinically significant anxiety symptoms, 10% shown clinically significant depression and 10% showed mixed anxiety depression disorders.

In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes) rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction) has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO). A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB) followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT) complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR). PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%), followed by fish meat (4.0%), and then beef (2.5%). Among various milk and milk products, curd (2.0%) showed the highest prevalence, followed by raw milk (1.3%). The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS) examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro) resulted positive in twenty four strong haemolysin producing L. monocytogenes isolates. The vero cytotoxicity assay could be suggested as a further step towards an alternative assay for detection of haemolytic strains of L. monocytogenes.

Comparative analysis of cultural isolation and PCR based assay for detection of Campylobacter jejuni in food and faecal samples

In the present study, the efficacy of polymerase chain reaction (PCR) based on mapA gene of C. jejuni was tested for detection of Campylobacter jejuni in naturally infected as well as spiked faecal and food samples of human and animal origin. Simultaneously, all the samples were subjected to the cultural isolation of organism and biochemical characterization. The positive samples resulted in the amplification of a DNA fragment of size ~589 bp in PCR assay whereas the absence of such amplicon in DNA extracted from E. coli, Listeria, Salmonella and Staphylococcus confirmed the specificity of the primers. Of randomly collected 143 faecal samples comprising human diarrheic stools (43), cattle diarrheic faeces (48) and poultry faecal swabs (52) only 4, 3 and 8, respectively, could be detected by isolation whereas 6, 3 and 10, respectively, were found positive by PCR. However, among food samples viz. beef (30), milk (35), cheese (30), only one beef sample was detected both by culture as well as PCR. Additionally, PCR was found to be more sensitive for C. jejuni detection in spiked faecal and food samples (96.1 percent each) as relative to culture isolation which could detect the organism in 86.7 percent and 80 percent samples, respectively. The results depicted the superior efficacy of PCR for rapid screening of samples owing to its high sensitivity, specificity and automation potential.

Prevalence of acid fast bacilli in Ajmer: A retrospective analysis of eight years data.

To assess prevalence of acid fast bacilli (AFB) in Ajmer, a retrospective analysis of 8 years was done in 1905 AFB cultures in various clinical specimens. All specimens were cultured on Lowenstein-Jensen slants after decontamination and concentration using modified Petroff's method. Smears were stained by Ziehl-Neelsen technique with acid and alcohol to exclude rapid growers. Four hundred and twenty eight AFB positive cultures were reported using morphological, staining and microscopic characteristics. Over all, AFB positive culture rate was 22.46%. Maximum positive cultures were from urinary system (253) followed by respiratory system (151), female genital systems (9), reticuloendothelial system (6), CNS (6), GIT (2), and CVS (1).

Incidence of Campylobacter species in animal handlers.

From the stool samples collected from diarrhoeic and healthy handlers of domestic animals different Campylobacter species were isolated in 16.6 and 21.1 per cent respectively. Both biotypes 1 and 2 were identified. All the 10 strains of C. jejuni were found to be enterotoxigenic or potentially enterotoxigenic in the ligated ileal loop of albino rats.